Detection of Mucin Gene Polymorphism 337
337
28
Detection of Mucin Gene Polymorphism
Lynne E. Vinall, Wendy S. Pratt, and Dallas M. Swallow
1. Introduction
1.1. The MUC Genes
The polypeptide backbones of mucins and mucin-type glycoproteins are each
encoded by one of multiple genes . At least nine distinct genes (MUC1, MUC2, MUC3,
MUC4, MUC5AC, MUC5B, MUC6, MUC7, and MUC8) that encode mucin-type pro-
teins expressed in epithelial cells have been reported in humans (1,2). The genes
encoding mucins are dispersed in the human genome, although a family of four related
genes—MUC2, MUC5AC, MUC5B, and MUC6—each of which encodes an apomucin
expressed in specialized secretory cells, is found on chromosome 11p15.5 (1). The
other genes appear to be rather different. MUC1, the first epithelial mucin gene to be
identified, is located on chromosome 1q21, and encodes a relatively small molecule
with a transmembrane anchor, which is widely expressed in epithelia and can be
detected at low levels in certain other cells (3). MUC3 (7q22) and MUC4 (3q29) are
extremely large and also have transmembrane anchors (5–7,7a–c). MUC3 and MUC4,
like the 11p15.5 mucin genes, show a restricted tissue distribution, but are expressed
in columnar cells as well as in specialized secretory cells (8,9). MUC7 (4q) encodes a
very small secreted glycoprotein (MG2) expressed primarily in salivary glands (10,11),
but there is little information about MUC8 (12q24.3) (2).
A common feature of the MUC genes is that they contain tandem repeats (TR) of
DNA sequence that lead to tandem repetition of amino acid motifs. These repeated
regions may comprise 50% or more of the polypeptide. The repeat units vary in
sequence and in length, from 24 nucleotides in MUC5AC to 507 nucleotides in MUC6,
and also in the extent to which they are conserved within each array (7,12–17).
1.2. MUC Gene Polymorphism (
see
Notes 1–9)

It has been known for some time that the human mucin genes show a high level
of polymorphism (7,16–22). The occurrence of polymorphism owing to variable
numbers of the tandem repeats (VNTRs) in mucin genes was first shown for MUC1.
From:
Methods in Molecular Biology, Vol. 125: Glycoprotein Methods and Protocols: The Mucins
Edited by: A. Corfield © Humana Press Inc., Totowa, NJ
338 Vinall et al.
The same restriction fragment polymorphism was observed with a number of different
restriction enzymes, each of which cuts outside the TR region (22), and the polymor-
phism was readily detectable in the protein product by sodium dodecyl sulfate (SDS)
gel electrophoresis (22,23) and also in the messenger RNA (24,25). To date, the extent
and nature of polymorphism has been assessed in seven of the nine MUC genes on a
large number of unrelated individuals, mainly of European extraction, in our labora-
tory and elsewhere. MUC1 (see Note 1), MUC2 (see Note 2), MUC3 (see Note 3),
MUC4 (see Note 4), MUC5AC (see Note 5), and MUC6 (see Note 6) were all found to
be highly polymorphic at least partly owing to VNTR, whereas MUC5B showed no
evidence of VNTR variation (see Note 7) (26). The relevant published work is refer-
enced in Table 1. We have not studied polymorphism of MUC7 and MUC8, but it has
been reported that there is a variation in the number (five or six) of the 69-bp TRs of
the small MUC7 molecule (see Note 8) (Table 1).
It is not clear at this stage what impact variation in the length of the TR regions of
the MUC genes is likely to have, but it should be noted that the predicted differences in
polypeptide length of MUC1, MUC2, MUC4, and MUC6 are substantial, since the
allele length differences are attributable to coding sequence and do not apparently
contain introns. Although it has been known for a long time that the VNTR polymor-
phism of MUC1 is detectable in the protein, direct evidence for this in the case of the
other genes is only now becoming available. For example, recent data reveal evidence
of the same VNTR polymorphism in the mRNAs encoding MUC2, MUC4, and MUC6
(27) and corresponding size differences in MUC2 glycoprotein subunits (27a). In the
case of MUC2 the smallest allele that our group has observed is approx 3.5 kb and the

very largest allele ever observed, by our collaborators, is 14 kb (26), a difference of
more than 150 23 amino acid repeat units. These sizes indicate that the alleles encode
full-length MUC2 polypeptides (prior to glycosylation) of about Mr 350,000 and
680,000, respectively, a twofold difference in size (28). MUC4 shows a dramatic 20-
kb difference in size between the smallest and largest alleles so far observed. If these
alleles are transcribed and translated in their entirety, this difference corresponds to
about Mr 700,000. It seems probable that such substantial differences will be of func-
tional importance, as, e.g., appears to be the case for apolipoprotein(a), which shows
similar variation in polypeptide length (29). Variation in length of mucins is likely to
have an impact on the properties of the mucous gel; thus, studies to investigate pos-
sible disease susceptibility associated with extreme allele lengths are worthwhile.
With the exception of MUC7, these polymorphisms involve gene length differ-
ences that are kilobases in size, and thus have been analyzed by electrophoresis of
restriction enzyme-digested DNA and hybridization with gene-specific cDNA probes
after transfer of the DNA onto nylon membranes (Southern blotting). We have devized
a procedure whereby six of the genes can be analyzed using only two restriction
enzyme digests (HinfI and PvuII). Table 1 also lists other restriction enzymes that can
be used to detect VNTR variation in these genes. In each case, it is important to select
an enzyme which cuts close to the repeats and to avoid enzymes that cut within the
TRs such as Taq1 in MUC2 (16), MUC5AC, and MUC6 (26). Note, however, that rare
allelic variation involving nucleotide substitutions that involve the restriction sites
Detection of Mucin Gene Polymorphism339
339
Table 1
Size and Distribution of the TR Domains and Enzymes Used for Their Detection
Chromosomal Recommended
Gene location Main TR enzyme VNTR range Other possible enzymes Refs.
MUC1 1q21 60 bp 20 amino acids: HinfI 2.8–8.0 kb EcoRI/PstI, AluI, etc
a
22,24,33,

35,36
MUC2 11p15.5 69 bp 23 amino acids: HinfI 3.3–11.4 kb PstI, BamHI/HindIII 16,20,26
MUC3 7q22 51 bp 17 amino acids (two zones): PvuII 7.0–15.0 kb PstI 4,
18
20–50 kb
a
MUC4 3q29 48 bp 16 amino acids: PvuII 6.5–27 kb PstI/EcoRI 7,19
MUC5AC 11p15.5 24 bp 8 amino acids (interrupted): HinfI 6.6kb/7.4kb PstI 26
PvuII
a
MUC5B 11p15.5 87 bp 29 amino acids (interrupted): BglII 16 kb
a
26
MUC6 11p15.5 507 bp 169 amino acids: PvuII 8–13.5kb
aa
17,26
MUC7 4q13-21 69 bp 23 amino acids: PCR
a
5/6 repeats
a
10,11
MUC8 12q24.3 41 bp Unknown No information 2
a
See text for comments.
340 Vinall et al.
themselves may sometimes complicate the picture. The detailed protocols are given in
Subheading 3. Full protocols for MUC7 are not given, but the appropriate literature is
cited (see Note 8).
Although at present the only way of analyzing this variation is by Southern blotting,
as outlined in Subheading 3.1., it may eventually be possible to find polymerase chain

reaction (PCR) formattable polymorphisms that are in linkage disequilibrium with the
VNTR alleles, which would allow analysis of more samples and would use less DNA. A
protocol for such a polymorphism within MUC1 is presented here (see Note 9).
2. Materials (
see
Notes 10 and 11)
1. Puregene kit for genomic DNA preparation (Flowgen, Sittingbourne, UK).
2. Restriction enzymes: HinfI and PvuII (Gibco-BRL, Life Technologies, Paisley, Scotland).
3. TBE buffer (1X = 0.89 M Tris-HCl, 0.1 M borate, 0.002 M EDTA buffer, pH 8.3): pre-
pared as a 10X or 5X stock (see Note 10).
4. For agarose electrophoresis: Horizon 20:25 apparatus, a 30-sample comb (Gibco-BRL),
and a small gel tank (minihorizontal unit, Anachem, Luton, UK) or equivalents.
5. Agarose (Sigma, Poole, UK).
6. Loading buffer for agarose gels: 0.25% bromophenol blue, 0.25% xylene cyanol, 40%
sucrose in water.
7. Transilluminator (U.V.P. International, Ultra-Violet Products, Cambridge, UK).
8. Hybond N+ membranes (Amersham Pharmacia Biotech, Buckinghamshire, UK).
9. Vacuum blotter (Vacugene XL, Amersham Pharmacia Biotech).
10. Multiprime DNA labeling kit (Amersham Pharmacia Biotech).
11. Sodium chloride/sodium citrate (SSC)-containing solutions: prepare from a stock of 20X
SSC (3 M NaCl, 0.3 M trisodium citrate) (see Note 11).
12. Denhardt’s solution: make as a 100X stock (2% [w/v] Ficoll 2% [w/v] polyvinylpyrroli-
done, 2% [w/v] bovine serum albumin, pH 7.2) and filter sterilized.
13. Sonicated Herring sperm DNA (Promega, Southampton, UK).
14. Molecular weight markers for agarose electrophoresis: Raoul markers (Appligene,
Durham, UK), 1-kb ladder (Gibco-BRL), λHindIII (Gibco-BRL), and control genomic
DNA samples containing alleles of known length.
15. Shaking water bath at 65°C.
16. Cling film (e.g., Clingorap, Terinex, Bedford, UK).
17. Luminescent marking solution (Glo-bug X-ray marking solution, Radleys, Saffron

Walden, UK).
18. Oligonucleotide primers AGAGAGTTTAGTTTTCTTGCTCC (CAS) and TTCTTGGCT
CTAATCAGCCC (CAA) (nucleotides 5915–5937 and 6092–6073 in Genbank/EMBL
M61170), one of which is labeled with fluorescein.
19. PCR machine (e.g., Perkin Elmer, Beaconsfield, UK).
20. Taq polymerase in storage buffer A (Promega).
21. Deoxynucleotides: “DNA polymerization mix” (Amersham Pharmacia Biotech). Make a
2 mM stock (1/10 of solution supplied).
22. Automated sequencing machine (ALF, Amersham Pharmacia Biotech).
23. Polyacrylamide gels prepared using 6% acrylamide (19:1 acrylamide to bis, Bio-Rad,
Herts, UK) in the molds supplied with the automated Sequencing machine.
24. Marker for the ALF acrylamide gels: 250-bp Sizer (Amersham Pharmacia Biotech).
25. Loading buffer: 5 µg/mL of Dextran Blue in 100% formamide.
Detection of Mucin Gene Polymorphism 341
3. Methods
3.1. Southern Blot Analysis (
see
Notes 5 and 12–16)
1. Prepare genomic DNA samples from whole blood or other convenient source, using the
appropriate Puregene kit, or other standard protocol or kit.
2. Quantify the DNA by measurement of OD
259
. Dilute sample approx 1/100 and then mul-
tiply by the dilution factor and the conversion factor of 50 to convert OD to micrograms
per milliliter.
3. Check the integrity of the DNA by agarose electrophoresis of 1 µL of each sample plus 2 µL
of loading buffer on small gels (0.8% in 1X TBE) in the presence of 50 ng/µL ethidium
bromide, and inspection under ultraviolet (UV) light using a transilluminator.
4. Treat 5–7 µg of DNA with restriction enzymes HinfI or PvuII, in a final volume of 25 µL
(with the buffer provided and as recommended by the manufacturers).

5. Check digestion of the DNA by electrophoresis of 3 µL of each sample plus 2 µL of
loading buffer on small gels (0.8% in 1X TBE) in the presence of 50 ng/µL of ethidium
bromide, and inspection under UV light .
6. For analysis of MUC1, MUC2, and MUC5AC, separate the HinfI fragments (22 µL digest
plus 7 µL of loading buffer) by electrophoresis using 0.8% 20 × 25cm agarose gels in 1X
TBE, for 24 h at 2 V/cm.
7. For analysis of MUC3, MUC4, and MUC6, separate the PvuII fragments (22 µL digest
plus 7 µL of loading buffer) by electrophoresis using 0.5% 20 × 25cm agarose gels in 1X
TBE, at 2 V/cm for 24 h, followed by a complete change of the tank buffer, and continued
electrophoresis at 1.2 V/cm for a further 19 h.
8. Apply four kinds of markers to each gel: Raoul markers, 1-kb ladder, λHindIII, and DNA
samples with alleles of known size.
9. Following electrophoresis, visualize the markers by poststaining with 0.4 mg/mL of
ethidium bromide in distilled water for 20 min (see Note 12).
10. Record the migration of the marker bands by making a photographic record including a
clear ruler aligned to the leading edge of the wells.
11. Depurinate the DNA with 0.25 M HCl for 30 min, with occasional gentle agitation.
12. Denature with 1.5 M NaCl and 0.5 M NaOH for 30 min, with occasional gentle agitation.
13. Neutralize with 0.5 M Tris-HCl, 1.5 M NaCl, and 0.001 M EDTA, pH 7.2 for 30 min, with
occasional gentle agitation (see Note 13).
14. Transfer the digested DNA onto Hybond N+ membranes by capillary blotting overnight
or vacuum blotting for 2 h, both as recommended by the manufacturers, again aligning
the top of the membrane accurately.
15. Fix the DNA on to the filters by baking at 80°C for 2 h.
16. Detect the MUC genes using TR cDNA probes: PUM24P for MUC1 (30), SMUC41 for
MUC2 (13), SIB124 for MUC3 (31), JER64 for MUC4 (32), JER58 for MUC5AC (15),
and the cDNA reported in (17) for MUC6, and, when used, JER57 for MUC5B (14).
Label 25 ng by random primed labeling utilizing the Multiprime DNA labeling kit using
the solutions and protocol provided.
17. Prehybridize the filters in a plastic box in 200 mL of 6xSCC, 5X Denhardt’s and 0.5%

(w/v) SDS in a shaking water bath at 65°C (see Note 14).
18. After approx 4 h, prepare the hybridization solution. Add 500 µg of sonicated Herring
sperm DNA (Promega) to the labeled probe and boil for 5 min.
19. Add to the prehybridization solution and agitate the box to ensure that the probe is dis-
persed evenly.
20. Hybridize the filters overnight in the shaking water bath.